Aquaculture 264 (2007) 16 – 26 www.elsevier.com/locate/aqua-online
A genetic map of large yellow croaker Pseudosciaena crocea Yue Ning a , Xiande Liu a , Zhi Yong Wang a,⁎, Wei Guo a,b , Yiyun Li a , Fangjing Xie a a
The Key Laboratory of Science and Technology for Aquaculture and Food Safety, Fisheries College, Jimei University, Xiamen 361021, China b Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China Received 14 July 2006; received in revised form 25 December 2006; accepted 30 December 2006
Abstract Genetic linkage maps were constructed for large yellow croaker Pseudosciaena crocea (Richardson, 1846) using AFLP and microsatellite markers in an F1 family. Five hundred and twenty-three AFLP markers and 36 microsatellites were genotyped in the parents and 94 F1 progeny. Among these, 362 AFLP markers and 13 SSR markers followed the 1:1 Mendelian segregation ratio (P N 0.05). The female genetic map contained 181 AFLP and 7 microsatellite markers forming 24 linkage groups spanning 2959.1 cM, while the male map consisted of 153 AFLP and 8 microsatellite markers in 23 linkage groups covering 2205.7 cM. One sex linked marker was mapped to the male map and co-segregated with the AFLP marker agacta355, suggesting an XY-male determination mechanism and this may be useful in the breeding of monosex populations. © 2007 Elsevier B.V. All rights reserved. Keywords: Pseudosciaena crocea; AFLP; Microsatellite; Genetic linkage map; Sex determination
1. Introduction Genetic maps have become essential tools in many fields of genetic studies and have been constructed in various organisms (Postlethwait et al., 1994; Dib et al., 1996; Dietrich et al., 1996; Groenen et al., 2000), including several aquaculture species (Kocher et al., 1998; Young et al., 1998; Sakamoto et al., 2000; Robison et al., 2001; Waldbieser et al., 2001). These maps have been efficiently used for various biological analyses, such as quantitative trait loci (QTL) (Jackson et al., 1998; Sakamoto et al., 1999; Ozaki et al., 2001; O'Malley et al., 2003), marker-assisted selection (Lande and Thompson, 1990; Fuji et al., 2006), comparative genome
⁎ Corresponding author. Tel.: +86 592 6183816; fax: +86 592 6181476. E-mail address:
[email protected] (Z.Y. Wang). 0044-8486/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2006.12.042
mapping (Naruse et al., 2000; Woods et al., 2000) and position-based cloning (Dietrich et al., 1996). Large yellow croaker (Pseudosciaena crocea Richardson, 1846), one of the most economically important marine fish in China, is mainly distributed in coastal regions of East Asia (Feng and Cao, 1979). Its wild population has severely declined since 1970's, and the commercial characteristics (growth rate, flesh quality and disease resistance) of the cultured stocks have also declined (Wang et al., 2002). The genetic improvement of farmed large yellow croaker has been relatively slow compared with other aquaculture species (Fjalestad et al., 2003; Garber and Sullivan, 2006). To date only a few breeding programs have been initiated through selective breeding and no genetic map has been constructed for large yellow croaker. A moderately dense linkage map can be made rapidly using amplified fragment length polymorphism (AFLP) markers. As a PCR-based technique, AFLP
Y. Ning et al. / Aquaculture 264 (2007) 16–26
could generate a large number of polymorphic markers without any prior knowledge of DNA sequences for the organism (Vos et al., 1995). Many initial genetic maps based on molecular markers have been successfully constructed primarily relying on AFLP markers in aquaculture species, such as tilapia, Oreochromis niloticus (Kocher et al., 1998) and rainbow trout, Oncorhynchus mykiss (Young et al., 1998). Nevertheless, transferring AFLP markers between labs, species, and even crosses are questionable; this deficiency could be overcome by using co-dominant markers such as microsatellites. But for large yellow croaker, only limited microsatellites are available. So in this study, AFLP markers with a small set of microsatellites were used to construct the maps of large yellow croaker.
17
2.3. AFLP analysis AFLP analysis was performed according to Vos et al. (1995) as modified by Wang et al. (2004). Briefly, genomic DNA was digested with two enzymes, EcoRI and MseI, and ligated to adapters to provide the complementary sequence for AFLP primers. Pre-amplification reactions were performed using EcoRI and MseI primers each with a single selective base. For the selective amplification two additional selective bases were used in both primers. The amplification products were resolved in the 6% denaturing polyacrylamide gels and run at 80 W using a Sequi-Gen GT (38 × 50) cm gel apparatus (BioRad, USA). The amplification products were visualized by silver staining (Wang et al., 2004). 2.4. Microsatellite analysis
2. Materials and methods 2.1. Mapping population The mapping population used in this study is an interpopulation hybrid family of large yellow croaker. Its female parent was sampled from a commercial pond. This pond stock was derived from around 36 mature large yellow croakers that had been trawled from a wild population on the East China Sea in 1986. The male parent was wild and caught from the East China Sea in the spawning season. The mapping population was obtained by artificial propagation. Ninety four two-yearold F1 progeny from this family were sampled, and the sex of the fish was determined by dissection to examine the gonad. 2.2. Genomic DNA extraction Genomic DNA was extracted from fin of the F1 progeny and their parents using standard phenol– chloroform technique with slight modifications (Wang et al., 2000). Fin samples (20–30 mg) were placed into individual sterile of 1.5 ml microcentrifuge tubes containing 550 μl TE buffer (100 mM NaCl, 10 mM Tris, pH 8, 25 mM EDTA, 0.5% SDS, and freshly added proteinase K, 0.1 mg/ml). The samples were incubated at 55 °C overnight, and subsequently extracted twice using phenol and then phenol/ chloroform (1:1). DNA was precipitated by adding two and a half volumes of ethanol, collected by brief centrifugation, washed twice with 70% ethanol, air dried, re-dissolved in TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 7.5), and quantified with a spectrophotometer.
Total of 36 microsatellite loci containing (CA) repeats that were isolated from an enriched large yellow croaker genomic DNA library were screened for mapping (Guo et al., 2004, 2005). All primers were synthesized by Sangon Biological Engineering Technology CO., Ltd (Shanghai, China). PCR amplification was performed in a 20 μl reaction volumes containing 40–100 ng template DNA, 1× PCR buffer (10 mM Tris, 50 mM KCl, pH 9.0, 200 μM of each dNTP (Promega, USA), the concentrations of MgCl2 varied depending on the locus, 0.5 U Taq polymerase, and 4 pmol of each primer. PCR cycling was carried out on an Autorisierter Thermocycler (Eppendorf, German) with the initial denaturing at 95 °C for 2 min, followed by 30 cycles of 30 s denaturing at 95 °C, 30 s annealing at locus-specific temperatures, 30 s extension at 72 °C, and a final extension for 10 min at 72 °C. The PCR products were denatured and visualized using denaturing polyacrylamide gels (6%) followed by silver staining. 2.5. Markers scored and nomenclature AFLPs were scored as dominant markers. Then the genotypes of the parents for a given marker were inferred from the marker phenotypes of the offspring. Only polymorphic bands that were presented in one (cross type Aa × aa) or both (Aa × Aa) parents and segregated in the progeny were scored. The AFLP markers were named according to the combination of the selective amplification primers used and the approximate product size, which were determined by using a 10 bp DNA Ladder (Invitrogen, USA). For example, for AFLP marker agacag255, the first three letters (aga) represent the selective nucleotides in the EcoRI primer, the next three
18
Y. Ning et al. / Aquaculture 264 (2007) 16–26
letters (cag) represent the selective nucleotides in the MseI primer, and the number at the end is the fragment length in base pairs (bp). Microsatellite markers were scored as codominant markers, and one of the two alleles from the heterozygous parent was selected for coding and linkage analysis. For example, if the parent genotypes are AB × BC (female × male), we would pick allele A for the female and allele C for the male for coding. 2.6. Linkage analysis Two parents and 94 offspring were genotyped for AFLP and microsatellite markers. Genotype data were entered in an Excel spreadsheet and prepared for analysis with the Map Manager QTXb16 software according to the instruction manual (Manly et al., 2001). Prior to linkage analysis, markers were tested for goodnessof-fit of observed with expected Mendelian ratios using chi-square test to eliminate markers significantly deviating from the expected ratios (P b 0.05). Parent-specific map was constructed using the heterozygous genetic markers present in one parent but not in the other as suggested by the two-way pseudo-testcross strategy (Grattapaglia and Sederoff, 1994). Linkage groups using F2 backcross model were formed with an initial P-value of 0.0001 with the “Make Linkage Groups” command in Map Manager. Following formation of linkage groups, the P-value was raised to 0.001. Linkage at P b 0.001 was considered significant. Using the command “Distribute”, linkage groups were brought together. Then, other previously unlinked markers were allocated to these new linkage groups, again using the “Distribute” command. Markers with non-random assortment after statistical analysis were added next. The “Ripple” function was then used to position markers in an order that maximizes the total LOD (logarithmic odds) score for linkage. The software also estimated the optimum order and genetic distance between markers in
centi-Morgans (cM) by using the “Kosambi” function in the software (Kosambi, 1944). Linkage groups were assigned in descending size. Maps were drawn using MapChart (Voorrips, 2002). 2.7. Estimate genome length and map coverage The expected genome lengths (Ge) of the male and female linkage maps were estimated in two ways; (1) The average marker spacing(s) was first calculated by dividing the total length of all linkage groups with the number of intervals (number of markers minus number of linkage groups). Then Ge1 was calculated by adding 2 s to the length of each linkage group to account for terminal chromosome regions (Fishman et al., 2001). (2) Ge 2 was determined according to the fourth method of Chakravarti et al. (1991) by multiplying the length of each linkage group a factor of (m + 1) / (m − 1), where m is the number of markers on each linkage group. Then the average of the two estimates was used as the estimated genome length (Ge) for the large yellow croaker. Gof /Ge determined the observed genome coverage, where Gof is the length of the framework map. 3. Results 3.1. Genotypes In AFLP analysis, all of the 64 primer pairs on a panel of six progeny and their parents were tested firstly. The number of polymorphic markers for each primer combination was shown in Table 1. The frequency of polymorphic markers per primer combination ranged from 0 (AGT + CAT, ACG + CAC) to 31 (AGA + CTG). Twentynine primer combinations generating more than seven polymorphic markers were selected for genotyping all the 94 offspring. A total of 523 polymorphic loci were produced with the 29 AFLP primer pairs with an average
Table 1 Numbers of polymorphic markers generated by 64 different AFLP primer combinations M/E
E-ACC
E-AAC
E-AGT
E-AGG
E-ACG
E-AGA
E-AGC
E-AAG
Total
M-CAG M-CAT M-CTC M-CTA M-CAC M-CAA M-CTG M-CTT Total
9 6 14 10 3 4 16 4 66
4 5 17 21 0 2 5 22 76
18 0 3 6 2 17 3 21 70
3 6 3 19 4 13 2 30 80
5 2 4 3 0 2 4 7 27
17 14 22 15 4 25 31 23 151
21 5 0 2 0 5 21 14 68
22 6 11 3 4 16 24 13 99
99 44 74 79 17 84 106 134 637
Twenty-nine primer combinations with more than 7 polymorphic markers (bold) were chosen for genome mapping. E and M indicate the sequences GACTGCGTACCAATTC and GATGAGTCCTGAGTAA, respectively.
Y. Ning et al. / Aquaculture 264 (2007) 16–26
19
Table 2 Primer sequence and annealing temperatures of 13 informative microsatellite markers Name
Primer forward
Primer reverse
Tm(°C)
LYC0002 LYC0006 LYC0007 LYC0009 LYC0011 LYC0012 LYC0013 LYC0018 LYC0020 LYC0024 LYC0030 LYC0033 LYC0036
ACCTCCAGTGGGATGTGA GGTCAACAGGTCAGCAGTTA GACTCCTTTGCTCGGTCTGA GTCAATCACGTCTGTCTCTGC CTTTTATTGGCTCCGTATGA CAGAACAAACAATGAATGGG GCTGCGAGCTACTTTACTCAT CTGAGACCATGTGAGCAGTT GCCAAACATGGAGCCTTATG GGCTCGTGCCAGCAGGG GAGACGAGGAGAGGCAGAAG GGATGGAGGAGTGATGATGG GCATTCATGGATTAGACTGC
GGCTGTTTGTTATAATTTGTG GCATCTCTCCTTCAAGTCAC ACATGGTTATCCTTCCGTTCG TCAGCCATTGTCTGTGAGGT CACTCACACTAGCACGCAC GAGGAGCTCAACAGCAACA AACTCACAAACATGCAC GTGACCCAGTCCATGAGAAC GACTATCATCAACTGAAACAAC GTATGAAGAACATGTGCAGTG CACCATGGTAGAAAGAGCACAG GCACTGAGACCTGAATGCTCC GGGTGAGTGTCGGAAGTTC
50 55→50 55 60 55 55 50 55→50 55→50 55→50 60 50 50
of 18 markers per primer pair. Among all the polymorphic markers, 231 (44.2%) dominantly inherited bands were from the female parent, 191 (36.5%) were from the male and 101 (19.3%) existed in both parents. For microsatellite analysis, the parents were first screened for polymorphisms of all microsatellite loci. If a polymorphism was detected, the marker would be amplified for all 94 progeny. Of the 36 microsatellite loci analyzed, 13 loci were found informative, whose sequences of primers and annealing temperatures are shown in Table 2. Among the 13 informative microsatellites, only heterozygous markers could be used to construct the maps. Eight markers with AB × CD (LYC0009 and LYC0013) or AB × AC (LYC0012, LYC0018, LYC0020, LYC0024, LYC0033 and LYC0036) segregation type were useful for both female and male maps, three markers (LYC0002, LYC0006 and LYC00030) with AB × AA (female × male) segregation type only valued for the female map, and the marker LYC0007 and LYC0011 with AA × BC (female × male) segregation type only valued for the male map.
For the male map, the total of 201 markers was obtained from the male parent, among which 30 markers showed a significant distortion from the expected 1:1 ratio (P b 0.05), and then 171 markers were used for linkage analysis (Table 3). One hundred and sixty-one markers (153 AFLP and 8 microsatellite markers) were assigned to the male map (Table 3) and 10 markers were unlinked. The total length of the male map, which consisted of 23 linkage groups, was 2205.7 cM with an average distance of 15.9 cM (Fig. 1, B). The number of markers per group ranged from 2 to 20 with an average of 7 markers. By using 4 microsatellite markers (LYC0012, LYC0020, LYC0024 and LYC0033) heterozygous in both parents, 4 homologous pairs of linkage groups between the male and female maps have been identified (Fig. 2).
3.2. Linkage map
Table 3 Statistics for the male and female linkage maps of large yellow croaker
For the female map, the total of 242 markers was obtained from the female parent, among which 32 markers showed a significant distortion from the expected 1:1 ratio (P b 0.05), and then 210 markers were used for linkage analysis (Table 3). One hundred and eighty-eight markers (181 AFLP and 7 microsatellite markers) were assigned to the female map (Table 3) and 22 markers (including 4 microsatellite loci) were unlinked. The final linkage map consisted of 24 linkage groups spanning 2959.1 cM with an average distance of 18.0 cM (Fig. 1, A). The number of markers on each linkage group ranged from 2 to 19 with an average of 7.8 markers.
3.3. Genome length and coverage The observed framework map length was 2959.1 cM for the female and 2205.7 cM for the male map, respectively. After adding twice the average marker spacing of
Number of AFLP markers scored (no. distorted) Number of microsatellite markers scored (no. distorted) Number of markers mapped (no. AFLP and microsatellite mapped) Linkage groups Average number of markers per group Average intermarker spacing Minimum length of linkage map (cM) Maximum length of linkage map (cM) Total length of linkage groups (cM)
Female
Male
231 (32)
191 (30)
11 (0)
10 (0)
188 (181 + 7) 161 (153 + 8) 24 7.8 18.0 5.5 337.1 2959.1
23 7 15.9 15.4 284.3 2205.7
20
Y. Ning et al. / Aquaculture 264 (2007) 16–26
the female and male maps (18.0 and 15.9 cM, respectively) to the lengths of each linkage group (24 for the female and 23 for the male), the expected genome length
was increased to 3825.0 cM for the female and 2940.7 cM for the male map. While the second method yielded 3834.2 and 3000.2 cM for female and male map,
Fig. 1. Preliminary genetic linkage maps (A, female map; B, male map) of large yellow croaker with markers indicated on the right and genetic distances (in Kosambi cM) on the left. Markers were named after their primers and fragment size.
Y. Ning et al. / Aquaculture 264 (2007) 16–26
21
Fig. 1 (continued ).
respectively. The average estimated genome length was 3829.7 cM for the female and 2970.0 cM for the male. Therefore, the coverage of female and male maps, on the basis of these average estimates, was 77.3% and 74.3%, respectively.
3.4. Sex-determination locus The 94 progeny consisted of 50 females and 44 males, the sex was treated as a marker for the male and female linkage analyses. The sex was mapped to the
22
Y. Ning et al. / Aquaculture 264 (2007) 16–26
Fig. 2. Homologous groups in the female and male maps of large yellow croaker based on the shared microsatellite markers. Female and male linkage groups have been given the suffixes F and M, respectively.
12th linkage group of the male map, and tightly linked to marker agacta355 with zero recombination.
markers. Therefore, our mapping family would be a good choice of using the pseudo-testcross strategy to construct the linkage maps of the large yellow croaker.
4. Discussion 4.2. Genotyping 4.1. Mapping family This paper describes the first linkage map for the large yellow croaker, an important aquaculture species in China, by using a “two-way pseudo-testcross” mapping strategy. There is a positive correlation between the efficiency of pseudo-testcross strategy and the level of genetic heterozygosity of the species under study (Grattapaglia and Sederoff, 1994). In this study, the large yellow croaker mapping family was generated by a cross between highly heterozygous individuals from wild and cultured populations and therefore it has increased the probability of finding polymorphic
A total of 523 AFLP polymorphisms were detected by 29 selected primer combinations with an average of 18 polymorphisms per primer pair (Table 1). This was higher than 9.3 obtained from 12 selected primer pairs in tilapia (Kocher et al., 1998). Considering all of the 64 primer pairs, the average polymorphic markers/primer was 10, which was slightly higher than 9.4 in channel catfish by using an interspecific hybrid resource family (Liu et al., 2003), much higher than 7.6 for Medaka and 5.8 for Atlantic salmon, both obtained using a pure-bred population (Naruse et al., 2000; Moen et al., 2004). The variable ratio of AFLP markers observed might be
Y. Ning et al. / Aquaculture 264 (2007) 16–26
attributed to the differences in levels of polymorphism between different species. Among the 64 primer pairs, the number of the polymorphisms per primer pair varied a lot. Several primer pairs such as E-AGG/M-CTT, E-AGA/M-CAA and E-AGA/M-CAC produced over 25 polymorphic markers. However, 10 primer pairs produced less than 3 polymorphic markers (Table 1). When the polymorphic markers were correlated with the primer combinations, it appeared that large numbers of polymorphic markers generated with certain primer combinations, For instance, when 8 primer pairs with EcoRI -AGA was used, they produced 134 (21.0%) markers while primer pairs with MseI-CTT produced 151 (23.7%) polymorphic markers. Interestingly, the AFLP primer pair with MseI-CTT also produced the most polymorphic markers in tilapia (Kocher et al., 1998). More polymorphisms detected by these primer pairs might due to more mutations in the DNA sequence corresponding to selective region of the primers and then lead to abolishing or creating more AFLP bands. Nevertheless, it was efficient to generate adequate polymorphic markers by using the 29 chosen primer pairs, and the polymorphisms of all 64-primer pairs would provide a guideline for AFLP primer selection in the large yellow croaker. Clustering of AFLP markers might appear on a recombination-based map for the lack of recombination in that region, which was observed in many mapping experiments (Kocher et al., 1998; Young et al., 1998; Sakamoto et al., 2000). In the present study, most AFLP markers were randomly distributed as in other reports (Remington et al., 1999; Wang et al., 2005; Liu et al., 2006). For channel catfish, Ictalurus punctatus, many of the clustered AFLP markers were thought to be at a position close to centromeres as well as at the end of chromosomes (Liu et al., 2003). Young et al. (1998) suggested that the AFLP clusters should identify the heterochromatic regions associated with centromeres. Several potential causes were suggested by Liu et al. (2003), such as a reduced recombination rate around centromere regions and/or telomere regions, uneven distribution of restriction sites, presence of highly repetitive elements, etc. However, high level of marker clustering is not well understandable. During some linkage analyses, the level of AFLP clustering was increased with the number of AFLP markers that might be one of the most important reasons (Liu et al., 2003; Naruse et al., 2000). In that case, it would be proved through the next generation of higher-density of large yellow croaker linkage maps with more AFLP markers. By using 13 informative microsatellites selected from 36 microsatellites, a total of 7 and 8 microsatellites were successfully assigned to the female and male map
23
respectively. Meanwhile 4 homologous pairs of linkage groups have also been found by using the shared microsatellites markers. Although their efficiency was lower compared with AFLPs, microsatellites have become the preferred marker to construct genetic map because of their high level of heterozygosity, and transferability across strains or species. The microsatellite markers based genetic maps would have great potential to be applied in many aspects such as genetic diversity monitoring or parentage fingerprint in selective breeding programs. In further study, more microsatellites may help to locate genes for quantitative trait loci (QTL) controlling traits of economic importance and to produce an integrated map for large yellow croaker. 4.3. Linkage mapping The current female linkage map contains 24 linkage groups covering 2959.1 cM, while the male map has 23 linkage groups covering 2205.7 cM. The haploid genome of large yellow croaker has 24 chromosomes (Quan et al., 2000). Therefore, our linkage groups were in good agreement with (in female) or close to (in male) the haploid chromosome number. The lack of exact agreement between the number of linkage groups and chromosomes number is common for linkage mapping studies (Li and Guo, 2004; Liu et al., 2006). By using two kinds of methods to estimate the genome length, the average estimate length was 3829.7 cM for female and 2970.0 cM for male with coverage of 77.3% and 74.3%, respectively. The presence of unlinked markers also indicated that the true map length would be larger than what observed. In addition, 7 small groups (less than 5 markers) in the female map and 10 in the male, suggested that the markers are sparse in a few regions of genome and dense in others. Additional markers are required to fill the gaps, condense the existing maps and identify homologous female and male linkage groups. 4.4. Sex-specific recombination ratio Our results showed that the genome sizes between the male and female maps were clearly different. The calculated female's map length was 1.4-fold higher than the male's, which demonstrated a high level of recombination suppression in males. The recombination ratio difference between sexes has been observed in cattle, human, mouse and fish, and the heterogametic sex had lower recombination ratio indeed (Barendse et al., 1994; Dib et al., 1996; Dietrich et al., 1996; Sakamoto et al., 2000; Singer et al., 2002).
24
Y. Ning et al. / Aquaculture 264 (2007) 16–26
In some fish species, the difference has been shown to be significant, such as in tiger pufferfish, zebrafish and rainbow trout where the recombination ratio of female: male (F: M) found to be 2.17:1, 2.74:1 and 3.25:1, respectively (Kai et al., 2005; Singer et al., 2002; Sakamoto et al., 2000). While in Atlantic salmon the F: M ratio was 8.26:1, the unusually highest ratio detected (Moen et al., 2004). It is possible that the difference may be shared by all teleosts. 4.5. Sex-linked marker The confirmation of sex-linked markers on the paternal, but not the maternal map may validate the hypothesis that the male was the heterogametic sex in large yellow croaker, as Xie et al. (2004) described. Research of sex-determination mechanism has been carried out in many fish species (Thorgaard, 1977; Amores et al., 1998; Devlin and Nagahama, 2002), however, study of the sex determination in large yellow croaker is still largely unknown. To date, sex chromosome has not been observed, nor has any other environmental sex-determination factors. Markers linked to sex-determining loci have been found in many species (Waldbieser et al., 2001; Li et al., 2003; Felip et al., 2005; Lee et al., 2005). Fortunately, one AFLP locus was completely linked to the sex-determined region in this study, which could be used as a starting point for fine mapping and identification of the sex-determining locus or cytologically identify sex chromosome by fluorescent in situ hybridization (FISH), and it has potentials for eventually yielding sex-determining gene sequences in larger yellow croaker. As important tools for aquaculture, manipulation of sex ratio and sexual maturation has been initiated in our laboratory. To take advantage of the faster growth rates in female (unpublished data), the production of allfemale larger yellow croaker will be desirable. With the help of the molecular marker, XX and XY fish could be rapidly identified, then feminization can be more efficiently produced by mating the normal females with masculinized females. 5. Conclusion In conclusion, genetic linkage maps were constructed for the large yellow croaker using AFLP and microsatellite markers. The sex-determination locus was mapped to the male map, suggesting an XY-male determination mechanism, and the female's and male's genome coverage were 77.3% and 74.3%, respectively. The genetic maps presented here provide a starting point
for the eventual construction of high-density maps, and the mapping of economically important genes and QTL in the large yellow croaker. Acknowledgments We would like to thank Haiyan Li and Cuiluan Yao for their help in data collection and for reviewing this paper, Jiafu Liu and Chuanjin Yuan for their contributions in rearing the fish families. This study was supported by the National Natural Science Foundation of China (30271037), the National High Technology Research and Development Program of China (2002AA603021 & 2006AA10A405), the Science and Technology Key Project of Fujian Province (2004NZ031) and the Foundation for Innovative Research Team of Jimei University (2006A001). References Amores, A., Force, A., Yan, Y.L., Joly, L., Amemiya, C., Fritz, A., Ho, R.K., Langeland, J., Prince, V., Wang, Y.L., Westerfield, M., Ekker, M., Postlethwait, J.H., 1998. Zebrafish hox clusters and vertebrate genome evolution. Science 282, 1711–1714. Barendse, W., Armitage, S.M., Kossarek, L.M., Shalom, A., Kirkpatrick, B.W., Ryan, A.M., Clayton, D., Li, L., Neibergs, H. L., Zhang, N., Grosse, W.M., Weiss, J., Creighton, P., McCarthy, F., Ron, M., Teale, A.J., Fries, R., McGraw, R.A., Moore, S.S., Georges, M., Soller, M., Womack, J.E., Hetzel, D.J.S., 1994. A genetic linkage map of the bovine genome. Nat. Genet. 6, 227–235. Chakravarti, A., Lasher, L.K., Reefer, J.E., 1991. A maximum likelihood method for estimating genome length using genetic linkage data. Genetics 128, 175–182. Devlin, R.H., Nagahama, Y., 2002. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208, 191–364. Dib, C., Faure, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Kazan, J., Seboun, E., Lathrop, M., Gyapay, G., Morissette, J., Weissenbach, J., 1996. A comprehensive genetic map of the human genome based on 5246 microsatellites. Nature 380, 152–154. Dietrich, W.F., Miller, J., Steen, R., Merchant, M.A., DamronBoles, D., Husain, Z., Dredge, R., Daly, M.J., Ingalls, K.A., O'Connor, T.J., 1996. A comprehensive genetic map of the mouse genome. Nature 380, 149–152. Felip, A., Young, W.P., Wheeler, P.A., Thorgaard, G.H, 2005. An AFLP-based approach for the identification of sex-linked markers in rainbow trout (Oncorhynchus mykiss). Aquaculture 247, 35–43. Feng, Z., Cao, Q., 1979. Ichthyology. Agricultural Press House, Beijing, China, pp. 154–155 (in Chinese). Fishman, L., Kelly, A.J., Morgan, E., Willis, J.H., 2001. A genetic map in the Mimulus guttatus species complex reveals transmission ratio distortion due to heterospecific interactions. Genetics 159, 1701–1716. Fjalestad, K.T., Moen, T., Gomez-Raya, L., 2003. Prospects for genetic technology in salmon breeding programmes. Aquac. Res. 34, 397–406.
Y. Ning et al. / Aquaculture 264 (2007) 16–26 Fuji, K., Kobayashi, K., Hasegawa, O., Coimbra, M.R.M., Sakamoto, T., Okamoto, N., 2006. Identification of a single major genetic locus controlling the resistance to lymphocystis disease in Japanese flounder (Paralichthys olivaceus). Aquaculture 254, 203–210. Garber, A.F., Sullivan, C.V., 2006. Selective breeding for the hybrid striped bass (Morone chrysops, Rafinesque × M. saxatilis, Walbaum) industry: status and perspectives. Aquac. Res. 37, 319–338. Grattapaglia, D., Sederoff, R., 1994. Genetic linkage maps of Eucalyptus grandis and Eucalyptus urophylla using a pseudo-testcross: mapping strategy and RAPD markers. Genetics 137, 1121–1137. Groenen, M.A.M., Cheng, H.H., Bumstead, N., Benkel, B.F., Briles, W.E., Burke, T., Burt, D.W., Crittenden, L.B., Dodgson, J., Hillel, J., Lamont, S., Leon, A.P., Soller, M., Takahashi, H., Vignal, A., 2000. A consensus linkage map of the chicken genome. Genome Res. 10, 137–147. Guo, W., Wang, Z., Wang, Y., Gui, J., 2004. Isolation of microsatellite markers in large yellow croaker by using FIASCO method. Program & Abstracts of the 4th Marine Biology and Biotechnology Symposium. April 21–25, 2004, Hong Kong, p. 132. Guo, W., Wang, Z., Wang, Y., Zhang, Z., Gui, J., 2005. Isolation and characterization of six microsatellite markers in the large yellow croaker (Pseudosciaena crocea Richardson). Mol. Ecol. Notes 5, 369–371. Jackson, T.R., Ferguson, M.M., Danzmann, R.G., Fishback, A.G., Ihssen, P.E., O'Connell, M., Crease, T.J., 1998. Identification of two QTL influencing upper temperature tolerance in three rainbow trout(Oncorhynnchus mykiss) half-sib families. Heredity 80, 143–151. Kai, W., Kikuchi, K., Fujita, M., Suetake, H., Fujiwara, A., Yoshiura, Y., Ototake, M., Venkatesh, B., Miyaki, K., Suzuki, Y., 2005. A genetic linkage map for the tiger pufferfish, Takifugu rubripes. Genetics 171, 227–238. Kocher, T.D., Lee, W.J., Sobolewska, H., Penman, D., McAndrew, B., 1998. A genetic linkage map of a cichlid fish, the tilapia (Oreochromis niloticus). Genetics 148, 1225–1232. Kosambi, D.D., 1944. The estimation of map distances from recombination values. Ann. Eugen. 12, 172–175. Lande, R., Thompson, R., 1990. Efficiency of marker-assisted selection in the improvement of quantitative traits. Genetics 124, 743–756. Lee, B.Y., Lee, W.J., Streelman, J.T., Carleton, K.L., Howe, A.E., Hulata, G., Slettan, A., Stern, J.E., Terai, Y., Kocher, T.D., 2005. A second-generation genetic linkage map of tilapia (Oreochromis spp.). Genetics 170, 237–244. Li, L., Guo, X., 2004. AFLP-based genetic linkage maps of the Pacific oyster Crassostra gigas, Thunberg. Mar. Biotechnol. 6, 26–36. Li, Y., Byrne, K., Miggiano, E., Whan, V., Moore, S., Keys, S., Crocos, P., Preston, N., Lehnert, S., 2003. Genetic mapping of the kuruma prawn Penaeus japonicus using AFLP markers. Aquaculture 219, 143–156. Liu, Z., Karsi, A., Li, P., Cao, D., Dunham, R., 2003. An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family. Genetics 165, 687–694. Liu, X., Liu, X., Guo, X., Gao, Q., Zhang, G., 2006. A preliminary genetic linkage map of the pacific abalone Haliotis discus hannai Ino. Mar. Biotechnol. 8, 386–397. Manly, K.F., Cudmore, R.H., Meer, J.M., 2001. Map Manager QTX, cross-platform software for genetic mapping. Mamm. Genome 12, 930–932. Moen, T., Hoyheim, B., Munck, H., Gomez-Raya, L., 2004. A linkage map of Atlantic salmon (Salmo salar) reveals an uncommonly
25
large difference in recombination rate between the sexes. Anim. Genet. 35, 81–92. Naruse, K., Fukamachi, S., Mitani, H., Kondo, M., Matsuoka, T., Kondo, S., Hanamura, N., Morita, Y., Hasegawa, K., Nishigaki, R., Shimada, A., Wada, H., Kusakabe, T., Suzuki, N., Kinoshita, M., Kanamori, A., Terado, T., Kimura, H., Nonaka, M., Shima, A., 2000. A detailed linkage map of medaka, Oryzias latipes: comparative genomics and genome evolution. Genetics 154, 1773–1784. O'Malley, K.G., Sakamoto, T., Danzmann, R., Ferguson, M., 2003. Quantitative trait loci for spawning time and body weight in rainbow trout: testing for conserved effects across ancestrally duplicated chromosomes. J. Heredity 94, 273–284. Ozaki, A., Sakamoto, T., Khoo, S.K., Nakamura, K., Coimbra, M.R.M., Akutsu, T., Okamoto, N., 2001. Quantitative trait loci (QTLs) associated with resistance/susceptibility to infectious pancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchus mykiss). Mol. Genet. Genomics 265, 23–31. Postlethwait, J.H., Johnson, S.L., Midson, C.N., Talbot, W.S., Gates, M., Ballinger, E.W., Africa, D., Andrews, R., Carl, T., Eisen, J.S., Horne, S., Kimmel, C.B., Hutchinson, M., Johnson, M., Rodriguez, A., 1994. A genetic linkage map for the zebrafish. Science 264, 699–703. Quan, C., Wang, J., Ding, S., Su, Y., Yao, J., 2000. The Êaryotypes of Pseudosciaena crocea (Richardson). J. Xiamen University (Nat. Sci. Ed.) 29, 107–110 (in Chinese, with English abstract). Remington, D.L., Whetten, R.W., Liu, B.H., O'Malley, D.M., 1999. Construction of an AFLP genetic map with nearly complete genome coverage in Pinus taeda. Theor. Appl. Genet. 98, 1279–1292. Richardson, J., 1846. Report on the ichthyology of the seas of China and Japan. Brit. Ass. Adv. Sci. Rep. 15th Meeting (1845), pp. 187–320. Robison, B.D., Wheeler, P.A., Sundin, K., Sikka, P., Thorgaard, G.H., 2001. Composite interval mapping reveals a major locus influencing embryonic development rate in rainbow trout (Oncorhynchus mykiss). J. Heredity 92, 16–22. Sakamoto, T., Danzmann, R.G., Okamoto, N., Ferguson, M.M., Ihssen, P.E., 1999. Linkage analysis of quantitative trait loci associated with spawning time in rainbow trout (Oncorhynchus mykiss). Aquaculture 173, 33–43. Sakamoto, T., Danzmann, R.G., Gharbi, K., Howard, P., Ozaki, A., Khoo, S.K., Woram, R.A., Okamoto, N., Ferguson, M.M., Holm, L.E., Guyomard, R., Hoyheim, B., 2000. A microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) characterized by large sex-specific differences in recombination rates. Genetics 155, 1331–1345. Singer, A., Perlman, H., Yan, Y., Walker, C., Corley-Smith, G., Brandhorst, B., Postlethwait, J., 2002. Sex-specific recombination rates in Zebrafish (Danio rerio). Genetics 160, 649–657. Thorgaard, G.H., 1977. Heteromorphic sex chromosomes in male rainbow trout. Science 196, 900–902. Voorrips, R.E., 2002. MapChart: software for the graphical presentation of linkage maps and QTLs. J. Heredity 93, 77–78. Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, T., Hornes, M., Frijters, A., Pot, J., Paleman, J., Kuiper, M., Zabeau, M., 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. Waldbieser, G.C., Bosworth, B.G., Nonneman, D.J., Wolters, W.R., 2001. A microsatellite-based genetic linkage map for channel catfish, Ictalurus punctatus. Genetics 158, 727–734. Wang, Z., Jayasankar, P., Khoo, S.K., Nakamura, K., Sumantadinata, K., Carman, O., Okamoto, N., 2000. AFLP fingerprinting reveals genetic variability in common carp stocks from Indonesia. Asian Fish. Sci. 13, 139–147.
26
Y. Ning et al. / Aquaculture 264 (2007) 16–26
Wang, Z., Wang, Y., Lin, L., Khoo, S., Okamoto, N., 2002. Genetic polymorphisms in wild and cultured large yellow croaker Pseudosciaena crocea using AFLP fingerprinting. J. Fish. Sci. Chin. 9, 199–202 (in Chinese, with English abstract). Wang, Z.Y., Tsoi, K.H, Chu, K.H., 2004. Applications of AFLP technology in genetic and phylogenetic analysis of penaeid shrimp. Biochem. Syst. Ecol. 32, 399–407. Wang, L., Song, L., Chang, Y., Xu, W., Ni, D., Guo, X., 2005. A preliminary genetic map of Zhikong scallop (Chlamys farreri Jones et Preston 1904). Aquac. Res. 36, 643–653.
Woods, I.G., Kelly, P.D., Chu, F., Ngo-Hazelett, P., Yan, Y., Huang, H., Postlethwait, J.H., Talbot, W.S., 2000. A comparative map of the zebrafish genome. Genome Res. 10, 1903–1914. Xie, F., Wang, Z., Liu, J., 2004. Induction of diploid gynogenesis in large yellow croaker, Pseudosciaena crocea. Abstracts of the 4th Marine Biology and Biotechnology Symposium. April 21–25, 2004. Hong Kong. Young, W.P., Wheeler, P.A., Coryell, V.H., Keim, P., Thorgaard, G.H., 1998. A detailed linkage map of rainbow trout produced using doubled haploids. Genetics 148, 839–850.
